Stem-loop sequence mmu-mir-7225

AccessionMI0023720 (change log)
Symbol MGI:Mir7225
DescriptionMus musculus miR-7225 stem-loop
Stem-loop
   --ac     --    g       ----  u 
5'     guaga  cugu uagaagc    cc c
       |||||  |||| |||||||    ||  
3'     cgucu  gaca aucuucg    gg u
   acga     cc    g       ucac  u 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 97690509-97690562 [-]
sense
OTTMUST00000104434 ; Pde4dip-001; 3'UTR (exon 46)
OTTMUST00000104435 ; Pde4dip-002; 3'UTR (exon 47)
ENSMUST00000168438 ; Pde4dip-001; 3'UTR (exon 46)
ENSMUST00000090750 ; Pde4dip-002; 3'UTR (exon 47)
Database links

Mature sequence mmu-miR-7225-5p

Accession MIMAT0028418
Sequence

1 - 

acguagacuguguagaagcc

 - 20

Get sequence
Deep sequencing24 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7225-3p

Accession MIMAT0028419
Sequence

33 - 

cuucuagacagccucugcagca

 - 54

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).