Stem-loop sequence mmu-mir-7224

AccessionMI0023719 (change log)
Symbol MGI:Mir7224
DescriptionMus musculus miR-7224 stem-loop
Literature search

1 open access papers mention mmu-mir-7224
(1 sentences)

Stem-loop
   --    a  -  c       a      c  g 
5'   gggu gg cc cucagug agauuu ag a
     |||| || || ||||||| |||||| ||  
3'   ccca cc gg gagucac ucuaga uc c
   ca    -  a  a       c      u  a 
Get sequence
Deep sequencing
428 reads, 0 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 67675457-67675516 [+]
intergenic
Database links

Mature sequence mmu-miR-7224-5p

Accession MIMAT0028416
Sequence

1 - 

ggguaggccccucagugaaga

 - 21

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7224-3p

Accession MIMAT0028417
Sequence

40 - 

uccacugagaggaccacccac

 - 60

Get sequence
Deep sequencing417 reads, 50 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).