Stem-loop sequence mmu-mir-7223

AccessionMI0023718 (change log)
Symbol MGI:Mir7223
DescriptionMus musculus miR-7223 stem-loop
Stem-loop
   --      ugc     ugu     u    ca    ca 
5'   uagcuu   ugagg   cgggg gugu  uacc  c
     ||||||   |||||   ||||| ||||  ||||   
3'   aucgaa   gcucu   guccc uaca  augg  a
   gg      caa     ---     u    --    uc 
Get sequence
Deep sequencing
710 reads, 6.25 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 107996848-107996916 [+]
antisense
OTTMUST00000006452 ; Prkca-003; intron 1
OTTMUST00000006450 ; Prkca-001; intron 8
ENSMUST00000134910 ; Prkca-003; intron 1
ENSMUST00000059595 ; Prkca-001; intron 8
Database links

Mature sequence mmu-miR-7223-5p

Accession MIMAT0028414
Sequence

1 - 

uagcuuugcugaggugucgg

 - 20

Get sequence
Deep sequencing438 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7223-3p

Accession MIMAT0028415
Sequence

53 - 

gucucgaacaagcuagg

 - 69

Get sequence
Deep sequencing211 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).