Stem-loop sequence mmu-mir-7222

AccessionMI0023717 (change log)
Symbol MGI:Mir7222
DescriptionMus musculus miR-7222 stem-loop
Stem-loop
   -g  a      aggcu   ag     cuac     - ug 
5'   gc cuugcc     cug  cugga    auacu c  u
     || ||||||     |||  |||||    ||||| |   
3'   cg ggacgg     gac  gaccu    uguga g  g
   ga  a      ---gu   ag     acuc     a uc 
Get sequence
Deep sequencing
2918 reads, 83.8 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 92594602-92594676 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-7222
mmu-mir-7221chr2: 92592206-92592277 [+]
mmu-mir-7222chr2: 92594602-92594676 [+]
Database links

Mature sequence mmu-miR-7222-5p

Accession MIMAT0028412
Sequence

1 - 

ggcacuugccaggcucugagcuggacu

 - 27

Get sequence
Deep sequencing781 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7222-3p

Accession MIMAT0028413
Sequence

53 - 

uccaggacagugggcaggagcag

 - 75

Get sequence
Deep sequencing583 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).