Stem-loop sequence mmu-mir-7221

AccessionMI0023716 (change log)
Symbol MGI:Mir7221
DescriptionMus musculus miR-7221 stem-loop
Literature search

1 open access papers mention mmu-mir-7221
(3 sentences)

Stem-loop
   --c      u g      -gu    ----------     a 
5'    gucucu g ucacag   gggu          ucuag g
      |||||| | ||||||   ||||          ||||| a
3'    cagggg c gguguc   cccg          agauc g
   ggu      u g      agu    acuggaggug     a 
Get sequence
Deep sequencing
590 reads, 10 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 92592206-92592277 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-7221
mmu-mir-7221chr2: 92592206-92592277 [+]
mmu-mir-7222chr2: 92594602-92594676 [+]
Database links

Mature sequence mmu-miR-7221-5p

Accession MIMAT0028410
Sequence

1 - 

cgucucuuggucacagguggg

 - 21

Get sequence
Deep sequencing169 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7221-3p

Accession MIMAT0028411
Sequence

52 - 

ugacugugggcuggggacugg

 - 72

Get sequence
Deep sequencing59 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).