Stem-loop sequence mmu-mir-7220

AccessionMI0023715 (change log)
Symbol MGI:Mir7220
DescriptionMus musculus miR-7220 stem-loop
Stem-loop
   --  --    cu    gua   u   -g  aa 
5'   gg  ugag  cuug   ccu ggc  ac  g
     ||  ||||  ||||   ||| |||  ||   
3'   cc  acuc  gaac   gga ccg  ug  a
   ag  ug    ug    -aa   c   ag  ga 
Get sequence
Deep sequencing
211 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 60953873-60953932 [+]
sense
OTTMUST00000039175 ; Camk2a-001; intron 6
OTTMUST00000039176 ; Camk2a-002; intron 6
OTTMUST00000039179 ; Camk2a-005; intron 6
ENSMUST00000102888 ; Camk2a-001; intron 6
ENSMUST00000025519 ; Camk2a-002; intron 6
ENSMUST00000137805 ; Camk2a-005; intron 6
Clustered miRNAs
< 10kb from mmu-mir-7220
mmu-mir-7220chr18: 60953873-60953932 [+]
mmu-mir-6982chr18: 60958073-60958140 [+]
Database links

Mature sequence mmu-miR-7220-5p

Accession MIMAT0028408
Sequence

1 - 

ggugagcucuugguaccuuggc

 - 22

Get sequence
Deep sequencing193 reads, 8 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mmu-miR-7220-3p

Accession MIMAT0028409
Sequence

38 - 

ccaggaacaaggucucaguccga

 - 60

Get sequence
Deep sequencing17 reads, 8 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).
2