Stem-loop sequence mmu-mir-7219

AccessionMI0023714 (change log)
Symbol MGI:Mir7219
DescriptionMus musculus miR-7219 stem-loop
Stem-loop
   --          -   a    ug     a 
5'   uguguuagag cuc gggu  agauc u
     |||||||||| ||| ||||  |||||  
3'   acacaaucuu ggg ccua  ucuag g
   uc          u   -    --     u 
Get sequence
Deep sequencing
106 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 68260920-68260973 [-]
sense
OTTMUST00000058466 ; AC111069.1-001; 3'UTR (exon 4)
ENSMUST00000042852 ; Fam210a-001; 3'UTR (exon 4)
Database links

Mature sequence mmu-miR-7219-5p

Accession MIMAT0028406
Sequence

1 - 

uguguuagagcucaggguugaga

 - 23

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7219-3p

Accession MIMAT0028407
Sequence

34 - 

uauccggguuucuaacacacu

 - 54

Get sequence
Deep sequencing101 reads, 48 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).