Stem-loop sequence mmu-mir-7218

AccessionMI0023713 (change log)
Symbol MGI:Mir7218
DescriptionMus musculus miR-7218 stem-loop
Stem-loop
   -ug    g uu    -   ---     a  u 
5'    cagg u  agug uag   agggg ca a
      |||| |  |||| |||   ||||| ||  
3'    gucc a  uuac guc   ucucc gu g
   ggg    g uc    u   caa     a  a 
Get sequence
Deep sequencing
1886 reads, 72.2 reads per million, 18 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 27358097-27358155 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-7218
mmu-mir-7217chr17: 27355738-27355799 [+]
mmu-mir-7218chr17: 27358097-27358155 [+]
Database links

Mature sequence mmu-miR-7218-5p

Accession MIMAT0028404
Sequence

1 - 

ugcaggguuuaguguagaggg

 - 21

Get sequence
Deep sequencing998 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7218-3p

Accession MIMAT0028405
Sequence

36 - 

cuaaccugucauucuagccugggg

 - 59

Get sequence
Deep sequencing773 reads, 14 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).