Stem-loop sequence mmu-mir-7217

AccessionMI0023712 (change log)
Symbol MGI:Mir7217
DescriptionMus musculus miR-7217 stem-loop
Stem-loop
   --aa    uau      a acaga     a  c 
5'     cuug   cuugug g     agggc cg c
       ||||   |||||| |     ||||| ||  
3'     gaac   gaacac c     ucccg gc u
   agaa    ---      c aagag     -  a 
Get sequence
Deep sequencing
21044 reads, 1.16e+03 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 27355738-27355799 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-7217
mmu-mir-7217chr17: 27355738-27355799 [+]
mmu-mir-7218chr17: 27358097-27358155 [+]
Database links

Mature sequence mmu-miR-7217-5p

Accession MIMAT0028402
Sequence

1 - 

aacuuguaucuugugagacagaagg

 - 25

Get sequence
Deep sequencing5211 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7217-3p

Accession MIMAT0028403
Sequence

41 - 

ugagaacccacaagcaagaaga

 - 62

Get sequence
Deep sequencing15567 reads, 20 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).