Stem-loop sequence mmu-mir-7216

AccessionMI0023711 (change log)
Symbol MGI:Mir7216
DescriptionMus musculus miR-7216 stem-loop
Stem-loop
   uggaga     c        ------    c      -cc   g 
5'       gcugg agaggacc      caga aagcca   ugc a
         ||||| ||||||||      |||| ||||||   |||  
3'       cggcc uuuucugg      guuu uucggu   acg a
   ------     -        uuuaag    c      uua   a 
Get sequence
Deep sequencing
367 reads, 21.1 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 27328385-27328460 [+]
intergenic
Database links

Mature sequence mmu-miR-7216-5p

Accession MIMAT0028400
Sequence

1 - 

uggagagcuggcagaggacccaga

 - 24

Get sequence
Deep sequencing31 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7216-3p

Accession MIMAT0028401
Sequence

56 - 

uggaauuuggucuuuuccggc

 - 76

Get sequence
Deep sequencing235 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).