Stem-loop sequence mmu-mir-7215

AccessionMI0023710 (change log)
Symbol MGI:Mir7215
DescriptionMus musculus miR-7215 stem-loop
Stem-loop
   --   c   a    caag u    ua 
5'   gcu uuu uguc    c gagc  c
     ||| ||| ||||    | ||||  a
3'   cga aag acgg    g cucg  a
   gg   a   -    -aga u    ua 
Get sequence
Deep sequencing
168 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 62682508-62682558 [+]
antisense
OTTMUST00000081734 ; Stox1-001; intron 1
OTTMUST00000081736 ; Stox1-003; intron 1
OTTMUST00000081735 ; Stox1-002; intron 2
ENSMUST00000133371 ; Stox1-001; intron 1
ENSMUST00000148720 ; Stox1-003; intron 1
ENSMUST00000126979 ; Stox1-002; intron 2
Database links

Mature sequence mmu-miR-7215-5p

Accession MIMAT0028398
Sequence

1 - 

gcucuuuauguccaagcugagcuac

 - 25

Get sequence
Deep sequencing51 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7215-3p

Accession MIMAT0028399
Sequence

29 - 

ugcucugagaggcagaaaagcgg

 - 51

Get sequence
Deep sequencing117 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).