Stem-loop sequence mmu-mir-7214

AccessionMI0023709 (change log)
Symbol MGI:Mir7214
DescriptionMus musculus miR-7214 stem-loop
Stem-loop
   --u    ucu     -   a    aau   uc 
5'    guuu   ggguu gga ugag   gug  u
      ||||   ||||| ||| ||||   |||   
3'    cgag   cccag ccu acuc   cac  c
   acg    uuc     u   g    --c   cc 
Get sequence
Deep sequencing
2286 reads, 100 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 27317035-27317095 [-]
intergenic
Database links

Mature sequence mmu-miR-7214-5p

Accession MIMAT0028396
Sequence

1 - 

uguuuucuggguuggaaugagaa

 - 23

Get sequence
Deep sequencing1621 reads, 18 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-7214-3p

Accession MIMAT0028397
Sequence

38 - 

cucaguccugaccccuugagcgca

 - 61

Get sequence
Deep sequencing244 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).