Stem-loop sequence mmu-mir-7213

AccessionMI0023708 (change log)
Symbol MGI:Mir7213
DescriptionMus musculus miR-7213 stem-loop
Stem-loop
   --     g                gaaa 
5'   acugg ucucuugagguagccu    g
     ||||| ||||||||||||||||    g
3'   ugacc agagaacuccaucggg    a
   uc     g                ggga 
Get sequence
Deep sequencing
143 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 79998970-79999026 [-]
sense
ENSMUST00000000500 ; Pdgfb-201; intron 5
Database links

Mature sequence mmu-miR-7213-5p

Accession MIMAT0028394
Sequence

1 - 

acugggucucuugagguagc

 - 20

Get sequence
Deep sequencing125 reads, 27 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mmu-miR-7213-3p

Accession MIMAT0028395
Sequence

38 - 

uaccucaagagagccagucu

 - 57

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).
2