Stem-loop sequence mmu-mir-7212

AccessionMI0023707 (change log)
Symbol MGI:Mir7212
DescriptionMus musculus miR-7212 stem-loop
Literature search

1 open access papers mention mmu-mir-7212
(1 sentences)

Stem-loop
   --         u      g     ggaa  u 
5'   ucugggggc ugugug uaggg    uc g
     ||||||||| |||||| |||||    || a
3'   ggaccucug acacac auccc    ag g
   cu         c      a     --ag  c 
Get sequence
Deep sequencing
1193 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 25948227-25948287 [+]
sense
ENSMUST00000110438 ; Fam134b-202; intron 2
ENSMUST00000022881 ; Fam134b-201; intron 3
Database links

Mature sequence mmu-miR-7212-5p

Accession MIMAT0028392
Sequence

1 - 

ucugggggcuugugugguagg

 - 21

Get sequence
Deep sequencing1186 reads, 54 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mmu-miR-7212-3p

Accession MIMAT0028393
Sequence

41 - 

uaacacacacgucuccagguc

 - 61

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).
2