Stem-loop sequence mmu-mir-7210

AccessionMI0023705 (change log)
Symbol MGI:Mir7210
DescriptionMus musculus miR-7210 stem-loop
Stem-loop
   --ua       ag  ag   --c    a 
5'     acauugu  ac  gca   aaag u
       |||||||  ||  |||   |||| c
3'     uguaaca  ug  ugu   uuuc c
   ucgg       -a  aa   aua    c 
Get sequence
Deep sequencing
25870 reads, 884 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 24088877-24088930 [+]
intergenic
Database links

Mature sequence mmu-miR-7210-5p

Accession MIMAT0028388
Sequence

1 - 

uaacauuguagacaggcacaaag

 - 23

Get sequence
Deep sequencing25531 reads, 31 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-7210-3p

Accession MIMAT0028389
Sequence

31 - 

uuauauguaaguaacaauguggcu

 - 54

Get sequence
Deep sequencing314 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).