Stem-loop sequence mml-mir-892c

AccessionMI0023703 (change log)
DescriptionMacaca mulatta miR-892c stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --            ugc    c  uuag 
5'   uauucagaaagg   cagu ac    a
     ||||||||||||   |||| ||    u
3'   gugagucuuucc   guca ug    u
   ag            uuu    c  uaca 
Get sequence
Deep sequencing
977 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 139700246-139700302 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-892c
mml-mir-891achrX: 139707844-139707922 [-]
mml-mir-892bchrX: 139704339-139704415 [-]
mml-mir-892achrX: 139703810-139703884 [-]
mml-mir-888chrX: 139702255-139702331 [-]
mml-mir-890chrX: 139701729-139701800 [-]
mml-mir-892cchrX: 139700246-139700302 [-]
Database links

Mature sequence mml-miR-892c-5p

Accession MIMAT0028384
Sequence

1 - 

uauucagaaaggugccagucac

 - 22

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-892c-3p

Accession MIMAT0028385
Sequence

36 - 

cacuguuuccuuucugagugga

 - 57

Get sequence
Deep sequencing968 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).