Stem-loop sequence mml-mir-7208

AccessionMI0023702 (change log)
DescriptionMacaca mulatta miR-7208 stem-loop
Stem-loop
   --        c             gga 
5'   aacugagc uugcuuugcuuug   a
     |||||||| |||||||||||||    
3'   uugacucg aacgaaacgaaau   a
   gg        a             aca 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 122205717-122205770 [-]
intergenic
Database links

Mature sequence mml-miR-7208-5p

Accession MIMAT0028382
Sequence

1 - 

aacugagccuugcuuugcuuu

 - 21

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7208-3p

Accession MIMAT0028383
Sequence

34 - 

agcaaagcaaagcucaguugg

 - 54

Get sequence
Deep sequencing47 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).