Stem-loop sequence mml-mir-7207

AccessionMI0023701 (change log)
DescriptionMacaca mulatta miR-7207 stem-loop
Stem-loop
   --                    uacu  a 
5'   aucuuuuaaaauacagaggg    gu a
     ||||||||||||||||||||    || u
3'   uaggaaauuuuaugucuccc    ca g
   cg                    uuuc  g 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 118648696-118648754 [-]
intergenic
Database links

Mature sequence mml-miR-7207-5p

Accession MIMAT0028380
Sequence

1 - 

aucuuuuaaaauacagaggg

 - 20

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7207-3p

Accession MIMAT0028381
Sequence

40 - 

cucuguauuuuaaaggaugc

 - 59

Get sequence
Deep sequencing16 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).