Stem-loop sequence mml-mir-7206

AccessionMI0023700 (change log)
DescriptionMacaca mulatta miR-7206 stem-loop
   --                       c -   g 
5'   cgugaguugaaaauauccuaagu g aaa u
     ||||||||||||||||||||||| | ||| g
3'   guacucaacuuuuauaggauuca c uuu c
   ua                       a a   a 
Get sequence
Deep sequencing
1604 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 19270331-19270394 [-]
Database links

Mature sequence mml-miR-7206-5p

Accession MIMAT0028378

1 - 


 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7206-3p

Accession MIMAT0028379

43 - 


 - 64

Get sequence
Deep sequencing1604 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).