Stem-loop sequence mml-mir-7205

AccessionMI0023699 (change log)
DescriptionMacaca mulatta miR-7205 stem-loop
Stem-loop
   -uc ag      c gg c      a  uuuc 
5'    g  gggcgu g  g caggga gc    a
      |  |||||| |  | |||||| ||     
3'    c  cccgca c  c gucucu cg    a
   cgu cu      - -a a      -  ccau 
Get sequence
Deep sequencing
690 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 86149995-86150054 [+]
sense
Database links

Mature sequence mml-miR-7205-5p

Accession MIMAT0028376
Sequence

1 - 

ucgaggggcgucggggccagggaag

 - 25

Get sequence
Deep sequencing148 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7205-3p

Accession MIMAT0028377
Sequence

39 - 

ucucugacacacgcccuccugc

 - 60

Get sequence
Deep sequencing542 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).