Stem-loop sequence mml-mir-1911

AccessionMI0023698 (change log)
DescriptionMacaca mulatta miR-1911 stem-loop
Gene family MIPF0001787; mir-1911
Literature search

1 open access papers mention mml-mir-1911
(1 sentences)

Stem-loop
   --u   u     c       u    cau c 
5'    gag accgc augucug uggg   c a
      ||| ||||| ||||||| ||||   |  
3'    cuc uggug uacggac accc   g c
   cgu   -     u       c    ucu a 
Get sequence
Deep sequencing
176 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 108624040-108624098 [+]
antisense
ENSMMUT00000047835 ; LRCH2-201; intron 10
ENSMMUT00000024354 ; LRCH2-202; intron 11
Database links

Mature sequence mml-miR-1911-5p

Accession MIMAT0028374
Sequence

1 - 

ugaguaccgccaugucuguugg

 - 22

Get sequence
Deep sequencing161 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-1911-3p

Accession MIMAT0028375
Sequence

39 - 

accaggcauuguggucucugc

 - 59

Get sequence
Deep sequencing15 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).