Stem-loop sequence mml-mir-7204

AccessionMI0023697 (change log)
DescriptionMacaca mulatta miR-7204 stem-loop
Stem-loop
   --        u    c  c aua   gaa 
5'   uuggacuu ggug ua c   aag   u
     |||||||| |||| || |   |||   a
3'   agccugaa ccac au g   uuc   u
   ua        c    a  a -ca   aua 
Get sequence
Deep sequencing
129 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 82078075-82078132 [+]
intergenic
Database links

Mature sequence mml-miR-7204-5p

Accession MIMAT0028372
Sequence

1 - 

uuggacuuuggugcuaccaua

 - 21

Get sequence
Deep sequencing83 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7204-3p

Accession MIMAT0028373
Sequence

38 - 

cgauaacacccaaguccgaau

 - 58

Get sequence
Deep sequencing46 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).