Stem-loop sequence mml-mir-7203

AccessionMI0023696 (change log)
DescriptionMacaca mulatta miR-7203 stem-loop
Stem-loop
   --a   ug    -     aga u      gucac 
5'    ggg  gacu gucuc   g ggugau     u
      |||  |||| |||||   | ||||||     u
3'    ccc  cuga caggg   c ccacug     g
   gga   gu    u     --- -      auucu 
Get sequence
Deep sequencing
10304 reads, 33.3 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 46260880-46260943 [+]
intergenic
Database links

Mature sequence mml-miR-7203-5p

Accession MIMAT0028370
Sequence

1 - 

aggguggacugucucagaguggu

 - 23

Get sequence
Deep sequencing10232 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7203-3p

Accession MIMAT0028371
Sequence

45 - 

ccgggacuagucugcccagg

 - 64

Get sequence
Deep sequencing72 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).