Stem-loop sequence mml-mir-7202

AccessionMI0023695 (change log)
DescriptionMacaca mulatta miR-7202 stem-loop
Stem-loop
   --           u          ucug 
5'   uugggugacau uguagauguc    u
     ||||||||||| ||||||||||     
3'   ggcucgcugug acauuuacag    a
   ag           c          uucu 
Get sequence
Deep sequencing
2739 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 122411787-122411842 [-]
intergenic
Database links

Mature sequence mml-miR-7202-5p

Accession MIMAT0028368
Sequence

1 - 

uugggugacauuuguagaugu

 - 21

Get sequence
Deep sequencing2738 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7202-3p

Accession MIMAT0028369
Sequence

36 - 

auuuacacgugucgcucggga

 - 56

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).