Stem-loop sequence mml-mir-7201

AccessionMI0023694 (change log)
DescriptionMacaca mulatta miR-7201 stem-loop
Stem-loop
   --a                     ac   u 
5'    caaagagcugugguagaaagu  ggu g
      |||||||||||||||||||||  ||| c
3'    guuucucgacaccaucuuuca  cua u
   uuc                     --   a 
Get sequence
Deep sequencing
217 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 97586692-97586750 [-]
intergenic
Database links

Mature sequence mml-miR-7201-5p

Accession MIMAT0028366
Sequence

1 - 

acaaagagcugugguagaaagu

 - 22

Get sequence
Deep sequencing214 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7201-3p

Accession MIMAT0028367
Sequence

38 - 

uuucuaccacagcucuuugcuu

 - 59

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).