Stem-loop sequence mml-mir-7200

AccessionMI0023693 (change log)
DescriptionMacaca mulatta miR-7200 stem-loop
Stem-loop
   --uc      u -u   ca   a    uuaauau 
5'     ccccag c  ggc  cag gccu       c
       |||||| |  |||  ||| ||||       c
3'     gggguc g  ccg  guc cgga       a
   gugu      c uc   ac   -    cuaagag 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 62999102-62999168 [-]
sense
Database links

Mature sequence mml-miR-7200-5p

Accession MIMAT0028364
Sequence

1 - 

ucccccagucuggccacagagc

 - 22

Get sequence
Deep sequencing29 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7200-3p

Accession MIMAT0028365
Sequence

45 - 

ccugcagcccugccuggggugug

 - 67

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).