Stem-loop sequence mml-mir-7199

AccessionMI0023692 (change log)
DescriptionMacaca mulatta miR-7199 stem-loop
Stem-loop
   --caa            -      gag   a 
5'      uauguucaaaac ugaaag   auc a
        |||||||||||| ||||||   |||  
3'      auacaaguuuug acuuuc   ugg g
   uggag            g      -aa   a 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 91587248-91587307 [+]
intergenic
JSUE03132679.1: 207-266 [-]
intergenic
Database links

Mature sequence mml-miR-7199-5p

Accession MIMAT0028362
Sequence

1 - 

caauauguucaaaacugaaag

 - 21

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7199-3p

Accession MIMAT0028363
Sequence

39 - 

uucagguuuugaacauagaggu

 - 60

Get sequence
Deep sequencing22 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).