Stem-loop sequence mml-mir-7198

AccessionMI0023691 (change log)
DescriptionMacaca mulatta miR-7198 stem-loop
Stem-loop
   --             gugg       cuc 
5'   uucaggaacccag    guugggg   u
     |||||||||||||    |||||||   u
3'   aaguccuuggguc    caacuuc   c
   gu             --ga       uac 
Get sequence
Deep sequencing
483 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 82810134-82810190 [+]
antisense
ENSMMUT00000038971 ; CNGB3-201; intron 3
ENSMMUT00000025140 ; CNGB3-202; intron 3
Database links

Mature sequence mml-miR-7198-5p

Accession MIMAT0028360
Sequence

1 - 

uucaggaacccagguggguugggg

 - 24

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7198-3p

Accession MIMAT0028361
Sequence

36 - 

ucaacagcuggguuccugaaug

 - 57

Get sequence
Deep sequencing481 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).