Stem-loop sequence mml-mir-1247

AccessionMI0023690 (change log)
DescriptionMacaca mulatta miR-1247 stem-loop
Gene family MIPF0000669; mir-1247
Literature search

1 open access papers mention mml-mir-1247
(1 sentences)

Stem-loop
   --a  c   c  uu   c     ac  ugc 
5'    cc guc cg  cgu cccgg  gu   u
      || ||| ||  ||| |||||  ||    
3'    gg cag gc  gca gggcc  ca   c
   cga  u   a  -u   a     -c  ucu 
Get sequence
Deep sequencing
151 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163899899-163899956 [-]
intergenic
Database links

Mature sequence mml-miR-1247-5p

Accession MIMAT0028358
Sequence

1 - 

acccgucccguucguccccgga

 - 22

Get sequence
Deep sequencing54 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-1247-3p

Accession MIMAT0028359
Sequence

38 - 

cgggaacgucgagacuggagc

 - 58

Get sequence
Deep sequencing97 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).