Stem-loop sequence mml-mir-7197

AccessionMI0023689 (change log)
DescriptionMacaca mulatta miR-7197 stem-loop
Stem-loop
   cca g    ug  - ag    c   a  au 
5'    c gauc  gc c  ccac ugc gu  u
      | ||||  || |  |||| ||| ||  c
3'    g uuag  ug g  ggug gcg cg  c
   -ca g    gu  a ag    u   a  ac 
Get sequence
Deep sequencing
13019 reads, 1.09e+03 reads per million, 7 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 38833903-38833963 [-]
intergenic
Database links

Mature sequence mml-miR-7197-5p

Accession MIMAT0028356
Sequence

1 - 

ccacggaucuggccagccacc

 - 21

Get sequence
Deep sequencing737 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7197-3p

Accession MIMAT0028357
Sequence

43 - 

ugggagaguuggauuggac

 - 61

Get sequence
Deep sequencing12244 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).