Stem-loop sequence mml-mir-323b

AccessionMI0023688 (change log)
DescriptionMacaca mulatta miR-323b stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   --      u     gugaguuc         
5'   agguug ccgug        gcauuauu 
     |||||| |||||        ||||||| u
3'   uccagc ggcac        cguaguaa 
   uc      u     --auaacc         
Get sequence
Deep sequencing
452 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163390241-163390297 [+]
sense
ENSMMUT00000027898 ; 3'UTR (exon 1)
Clustered miRNAs
< 10kb from mml-mir-323b
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
Database links

Mature sequence mml-miR-323b-5p

Accession MIMAT0028354
Sequence

1 - 

agguuguccguggugaguucgca

 - 23

Get sequence
Deep sequencing36 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-323b-3p

Accession MIMAT0028355
Sequence

37 - 

cccaauacacggucgaccucu

 - 57

Get sequence
Deep sequencing416 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).