Stem-loop sequence mml-mir-7196

AccessionMI0023686 (change log)
DescriptionMacaca mulatta miR-7196 stem-loop
Stem-loop
   -uc  -                  a    
5'    ca ucccugaacucgagcuga ucg 
      || |||||||||||||||||| || c
3'    gu ggggacuugagcucgacu aga 
   aac  c                  a    
Get sequence
Deep sequencing
159 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 152916358-152916412 [+]
intergenic
Database links

Mature sequence mml-miR-7196-5p

Accession MIMAT0028352
Sequence

1 - 

uccaucccugaacucgagcuga

 - 22

Get sequence
Deep sequencing158 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mml-miR-7196-3p

Accession MIMAT0028353
Sequence

34 - 

agcucgaguucaggggcugcaa

 - 55

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).