Stem-loop sequence mml-mir-7195

AccessionMI0023685 (change log)
DescriptionMacaca mulatta miR-7195 stem-loop
Stem-loop
   --         -      u cuu   -uu  c 
5'   gcaggggga agggga g   gca   ga g
     ||||||||| |||||| |   |||   ||  
3'   cgucccccu uccccu c   cgu   cu u
   ga         c      c uau   ccu  c 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 139670474-139670535 [+]
intergenic
Database links

Mature sequence mml-miR-7195-5p

Accession MIMAT0028350
Sequence

1 - 

gcagggggaaggggaugcuugc

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7195-3p

Accession MIMAT0028351
Sequence

40 - 

uauccuccccucucccccugcag

 - 62

Get sequence
Deep sequencing25 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).