Stem-loop sequence mml-mir-7194

AccessionMI0023684 (change log)
DescriptionMacaca mulatta miR-7194 stem-loop
Stem-loop
   --uu a   g          uc   uaagu 
5'     g aau cagagucuga  cag     c
       | ||| ||||||||||  |||     u
3'     c uua gucuuagacu  guc     a
   ccau c   g          cc   cuaag 
Get sequence
Deep sequencing
164 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 29328120-29328180 [+]
intergenic
Database links

Mature sequence mml-miR-7194-5p

Accession MIMAT0028348
Sequence

1 - 

uugaaaugcagagucugaucc

 - 21

Get sequence
Deep sequencing153 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7194-3p

Accession MIMAT0028349
Sequence

41 - 

cucagauucuggauuccuacc

 - 61

Get sequence
Deep sequencing11 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).