Stem-loop sequence mml-mir-7193

AccessionMI0023683 (change log)
DescriptionMacaca mulatta miR-7193 stem-loop
Stem-loop
   -ga             u      gagguc 
5'    gugcuggguucug aggcca      u
      ||||||||||||| ||||||       
3'    uacgacucgagau uucggu      g
   uuc             u      gaugga 
Get sequence
Deep sequencing
173 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 81852670-81852728 [+]
intergenic
Database links

Mature sequence mml-miR-7193-5p

Accession MIMAT0028346
Sequence

1 - 

gagugcuggguucuguaggcca

 - 22

Get sequence
Deep sequencing27 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7193-3p

Accession MIMAT0028347
Sequence

39 - 

gcuuuuagagcucagcaucuu

 - 59

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).