Stem-loop sequence mml-mir-549b

AccessionMI0023682 (change log)
DescriptionMacaca mulatta miR-549b stem-loop
Gene family MIPF0000470; mir-549
Stem-loop
   --              a       ga    
5'   agagcucauccaua uugucau  ucu 
     |||||||||||||| |||||||  || g
3'   ucucgaguagguau aacagug  aga 
   ac              c       ac    
Get sequence
Deep sequencing
48 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 58404331-58404387 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-549b
mml-mir-549achr7: 58404316-58404410 [-]
mml-mir-549bchr7: 58404331-58404387 [+]
Database links

Mature sequence mml-miR-549b-5p

Accession MIMAT0028344
Sequence

1 - 

agagcucauccauaauugucau

 - 22

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-549b-3p

Accession MIMAT0028345
Sequence

36 - 

gacaacuauggaugagcucuca

 - 57

Get sequence
Deep sequencing38 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).