Stem-loop sequence mml-mir-7192

AccessionMI0023681 (change log)
DescriptionMacaca mulatta miR-7192 stem-loop
Stem-loop
   --           u          --a   g   u 
5'   ucacucagaau aaaaaacaau   acu ugg c
     ||||||||||| ||||||||||   ||| |||  
3'   agugagucuua uuuuuuguua   ugg acu u
   ac           -          cag   a   g 
Get sequence
Deep sequencing
1029 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 52240172-52240238 [+]
intergenic
Database links

Mature sequence mml-miR-7192-5p

Accession MIMAT0028342
Sequence

1 - 

ucacucagaauuaaaaaacaaua

 - 23

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7192-3p

Accession MIMAT0028343
Sequence

46 - 

uuguuuuuuauucugagugaca

 - 67

Get sequence
Deep sequencing1022 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).