Stem-loop sequence mml-mir-7191

AccessionMI0023680 (change log)
DescriptionMacaca mulatta miR-7191 stem-loop
Stem-loop
   --ua    a   --     -     aau     ag       c 
5'     caga ccu  cugag gcaug   ggagg  ggcaggc c
       |||| |||  ||||| |||||   |||||  |||||||  
3'     gucu gga  gacuc cgugu   uuucc  ucguucg a
   ugga    -   cc     u     -cc     -g       g 
Get sequence
Deep sequencing
200 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 65856783-65856862 [+]
intergenic
Database links

Mature sequence mml-miR-7191-5p

Accession MIMAT0028340
Sequence

1 - 

uacagaaccucugaggcau

 - 19

Get sequence
Deep sequencing198 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7191-3p

Accession MIMAT0028341
Sequence

60 - 

gcucucagccaggucugaggu

 - 80

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).