Stem-loop sequence mml-mir-769

AccessionMI0023677 (change log)
DescriptionMacaca mulatta miR-769 stem-loop
Gene family MIPF0000727; mir-769
Stem-loop
   --u        u   u   g    g   ugu 
5'    gagaccuc ggg ucu agcu uga   u
      |||||||| ||| ||| |||| |||    
3'    uucugggg cuc agg ucga gcu   g
   ugg        c   u   g    -   cuc 
Get sequence
Deep sequencing
34948 reads, 189 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 41396588-41396648 [+]
intergenic
Database links

Mature sequence mml-miR-769-5p

Accession MIMAT0028334
Sequence

1 - 

ugagaccucuggguucugagc

 - 21

Get sequence
Deep sequencing33695 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mml-miR-769-3p

Accession MIMAT0028335
Sequence

41 - 

ugggaucuccggggucuuggu

 - 61

Get sequence
Deep sequencing1249 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).