Stem-loop sequence mml-mir-548j

AccessionMI0023676 (change log)
DescriptionMacaca mulatta miR-548j stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548j
(2 sentences)

Stem-loop
   --              gc      auaga 
5'   aaaaguaauugugg  uuugcu     a
     ||||||||||||||  ||||||      
3'   uuuucauuaacgcc  aaaugg     a
   cg              aa      aaaug 
Get sequence
Deep sequencing
294 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 113296852-113296909 [-]
intergenic
Database links

Mature sequence mml-miR-548j-5p

Accession MIMAT0028332
Sequence

1 - 

aaaaguaauugugggcuuugc

 - 21

Get sequence
Deep sequencing51 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-548j-3p

Accession MIMAT0028333
Sequence

38 - 

aaaaaccgcaauuacuuuugc

 - 58

Get sequence
Deep sequencing243 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).