Stem-loop sequence mml-mir-7188

AccessionMI0023675 (change log)
DescriptionMacaca mulatta miR-7188 stem-loop
Stem-loop
   ---acu   g   a   ga  c    c  c 
5'       gug cac cag  ca ggac uu a
         ||| ||| |||  || |||| ||  
3'       uac gug guc  gu ccug ag u
   acuguc   g   c   uc  u    a  g 
Get sequence
Deep sequencing
181 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 130952572-130952630 [+]
intergenic
Database links

Mature sequence mml-miR-7188-5p

Accession MIMAT0028330
Sequence

1 - 

acuguggcacacaggacacgga

 - 22

Get sequence
Deep sequencing169 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7188-3p

Accession MIMAT0028331
Sequence

37 - 

cuugcucugcguggcaucuguca

 - 59

Get sequence
Deep sequencing11 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).