Stem-loop sequence mml-mir-7187

AccessionMI0023674 (change log)
DescriptionMacaca mulatta miR-7187 stem-loop
Stem-loop
   --               -           auau 
5'   agcuccguuauaauc uauaggaccac    a
     ||||||||||||||| |||||||||||     
3'   ucgaggcaauauuag auauccuggug    c
   ag               g           gcga 
Get sequence
Deep sequencing
85 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 123669110-123669174 [+]
intergenic
Database links

Mature sequence mml-miR-7187-5p

Accession MIMAT0028328
Sequence

1 - 

agcuccguuauaaucuauagg

 - 21

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7187-3p

Accession MIMAT0028329
Sequence

44 - 

uauaggauuauaacggagcuga

 - 65

Get sequence
Deep sequencing83 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).