Stem-loop sequence mml-mir-7186

AccessionMI0023673 (change log)
DescriptionMacaca mulatta miR-7186 stem-loop
Stem-loop
   --c                     gu 
5'    ugugguuccuguaugaagaca  a
      |||||||||||||||||||||  g
3'    acaccaaggacguacuucugu  c
   guu                     gg 
Get sequence
Deep sequencing
10855 reads, 100 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
JSUE03161488.1: 387-439 [+]
intergenic
Database links

Mature sequence mml-miR-7186-5p

Accession MIMAT0028326
Sequence

1 - 

cugugguuccuguaugaagaca

 - 22

Get sequence
Deep sequencing10795 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mml-miR-7186-3p

Accession MIMAT0028327
Sequence

32 - 

ucuucaugcaggaaccacauug

 - 53

Get sequence
Deep sequencing60 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).