Stem-loop sequence mml-mir-676-2

AccessionMI0023672 (change log)
DescriptionMacaca mulatta miR-676-2 stem-loop
Gene family MIPF0000471; mir-676
Stem-loop
   --   uu      c     uu   gaauu 
5'   cuc  caaccu aggac  gca     a
     |||  |||||| |||||  |||      
3'   gag  guugga uccug  cgu     a
   uu   uu      a     -c   aaggu 
Get sequence
Deep sequencing
1640 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
JSUE03075159.1: 669-725 [-]
intergenic
Database links

Mature sequence mml-miR-676-5p

Accession MIMAT0027113
Sequence

1 - 

cucuucaaccucaggacuugca

 - 22

Get sequence
Deep sequencing32 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-676-3p

Accession MIMAT0024325
Sequence

37 - 

ccguccuaagguuguugaguu

 - 57

Get sequence
Deep sequencing3796 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).