Stem-loop sequence mml-mir-7185

AccessionMI0023671 (change log)
DescriptionMacaca mulatta miR-7185 stem-loop
Stem-loop
   --uc                     auua 
5'     aggaucaggaucugcagagca    g
       |||||||||||||||||||||     
3'     uccugguccuagacgucucgu    u
   auaa                     gaua 
Get sequence
Deep sequencing
142 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 13938129-13938186 [-]
intergenic
Database links

Mature sequence mml-miR-7185-5p

Accession MIMAT0028324
Sequence

1 - 

ucaggaucaggaucugcagagc

 - 22

Get sequence
Deep sequencing93 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7185-3p

Accession MIMAT0028325
Sequence

37 - 

ucugcagauccugguccuaaua

 - 58

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).