Stem-loop sequence mml-mir-548i

AccessionMI0023670 (change log)
DescriptionMacaca mulatta miR-548i stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548i
(2 sentences)

Stem-loop
   --         ugca             c 
5'   aaaggucau    gauuuugccauua u
     |||||||||    |||||||||||||  
3'   uuuucagua    cuaaaacggugau u
   cg         ucug             u 
Get sequence
Deep sequencing
348 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 9687432-9687489 [+]
sense
ENSMMUT00000021835 ; HLCS-201; intron 2
Database links

Mature sequence mml-miR-548i-5p

Accession MIMAT0028322
Sequence

1 - 

aaaggucauugcagauuuugcc

 - 22

Get sequence
Deep sequencing126 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-548i-3p

Accession MIMAT0028323
Sequence

37 - 

caaaaucgucuaugacuuuugc

 - 58

Get sequence
Deep sequencing220 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).