Stem-loop sequence mml-mir-7184

AccessionMI0023669 (change log)
DescriptionMacaca mulatta miR-7184 stem-loop
Stem-loop
   ---a   g    g ca  u      ----u    g 
5'     ggg ccag c  aa gcucag     gagu u
       ||| |||| |  || ||||||     ||||  
3'     ccc gguc g  uu cgaguc     cucg c
   agug   a    - uc  c      cacgu    u 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 80126221-80126284 [+]
intergenic
Database links

Mature sequence mml-miR-7184-5p

Accession MIMAT0028320
Sequence

1 - 

aggggccaggccaaaugcucagu

 - 23

Get sequence
Deep sequencing26 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7184-3p

Accession MIMAT0028321
Sequence

42 - 

ugagccuucugcuggacccguga

 - 64

Get sequence
Deep sequencing31 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).