Stem-loop sequence mml-mir-7183

AccessionMI0023668 (change log)
DescriptionMacaca mulatta miR-7183 stem-loop
Stem-loop
   --  a       u        a  ugua 
5'   ug auuggua ugcaaaug ca    u
     || ||||||| |||||||| ||    g
3'   ac uaaccau acguuuac gu    c
   ac  a       u        g  uaaa 
Get sequence
Deep sequencing
381 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 10378454-10378510 [+]
intergenic
Database links

Mature sequence mml-miR-7183-5p

Accession MIMAT0028318
Sequence

1 - 

ugaauugguauugcaaaugaca

 - 22

Get sequence
Deep sequencing380 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7183-3p

Accession MIMAT0028319
Sequence

36 - 

gcauuugcauuaccaauacaca

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).