Stem-loop sequence mml-mir-3938

AccessionMI0023667 (change log)
DescriptionMacaca mulatta miR-3938 stem-loop
Stem-loop
   --          c           uuua 
5'   agauuaucua aagggaauuuu    a
     |||||||||| |||||||||||     
3'   ucuaauaggu uucccuuaaaa    u
   gg          a           uuuu 
Get sequence
Deep sequencing
3306 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 86330449-86330504 [+]
intergenic
Database links

Mature sequence mml-miR-3938-5p

Accession MIMAT0028316
Sequence

1 - 

agauuaucuacaagggaauuuu

 - 22

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-3938-3p

Accession MIMAT0028317
Sequence

35 - 

aauucccuuauggauaaucugg

 - 56

Get sequence
Deep sequencing3296 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).