Stem-loop sequence mml-mir-6529

AccessionMI0023666 (change log)
DescriptionMacaca mulatta miR-6529 stem-loop
Gene family MIPF0001771; mir-6529
Stem-loop
   ---     auc          a  gcg   au 
5'    gagag   agaggcgcag gu   uca  g
      |||||   |||||||||| ||   |||  u
3'    uucuc   uuuccguguc cg   agu  c
   aau     cau          -  --a   aa 
Get sequence
Deep sequencing
5855 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 41243236-41243296 [-]
intergenic
Database links

Mature sequence mml-miR-6529-5p

Accession MIMAT0028314
Sequence

1 - 

gagagaucagaggcgcagagu

 - 21

Get sequence
Deep sequencing5832 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mml-miR-6529-3p

Accession MIMAT0028315
Sequence

40 - 

ccugugccuuuuaccucuuuaa

 - 61

Get sequence
Deep sequencing23 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).